Today goals

• Things you should know before assembly
  1. Fastq format
  2. Fasta format
  3. GC- content
  4. Status of genome
• Step to bacterial sequencing analysis

Things you should know before assembly

Fastq format

start with @

@cc3e68c4-b53d-43da-be7e-b961113007e2          -> sequence name
ATCCGGAATCGGTTACTGTTGGGAACCTTTGC               -> sequence
+                                              -> quality line break
#%(*))++.2/148447;7+001./18-7-,,30&*2          -> quality score

Fasta format

start with >

>tig00000001				           -> sequence name
TGATAAAAGTATTCATATAATCTCCTATCATTTCAAAATTTAAT   -> sequence 
>tig00000002																	 
ATATTAGTGTGTCTATTTTATGGGGCTAGGAAAGGAGGTACATT

GC-content

the percentage of nitrogenous bases on a DNA or RNA molecule that are either guanine or cytosine $$ \frac{G+C}{A+T+G+C} \times 100 \% $$

Satuts of genome

1. contig

A contig is a set of overlapping DNA segments that together represent a consensus region of DNA.

2. scaffold

To bridge the gaps between the two contigs called scaffold.

3. complete

Didn’t have fragment, chromesome is in one contig

Step to bacterial sequencing analysis

Step 1. Quality Control - Assessing the quality of TGS

1.1 Checking raw read statistics

Tools : abyss-fac

$ abyss-fac -t 1 read.fastq contig.fasta

• n : Number of raw read

• N50 : A value that present 50% of sorted read set

• Max: longest read length

• Sum: Total read length

1.2 QC report

Tools : FastQC

$ fastqc -f read.fastq -o outdir

Step 2. Trimming Filtering Data - Preprocessing of raw data (optional)

2.1 Filter raw read

Tools : filtlong

Usually used in coverage too high, trim too short reads, and want to keep raw read in between a range

2.2 Demultiplexing, Trimming adapter (barcode)

Tools : porechop, deepbinner

$ porechop -i reads.fastq -o output.fastq # adapter trimming
$ porechop -i reads.fastq -b output.fastq # demultiplexing 

Step 3. Sequence Assembly - Long read genome assembly

3.1 De novo assembly

Tools : Canu, Unicycler, Flye, Ra

$ canu -p genomename -d outdir genomeSize=4.8m -nanopore-raw read.fastq
$ unicycler -l read.fastq -o outdir
		...

Step 4. Assembly Validation

4.1 Assembly evaluation

Tools: abyss-fac, assembly-stats

1. Total assembly size
2. Total number of sequence
3. Longest contig
4. Average contig size
5. N50

4.2 Assembly status graph

Tools : Bandage

Is it circular or linear ?

4.3 Sequence Similarity Search

Tools : BLAST, MiGA

4.4 Quality of genomes

Tools : Checkm, busco